Showing posts with label HSC Board Paper. Show all posts
Showing posts with label HSC Board Paper. Show all posts

HSC Biology Board Question Paper March 2023 - Maharashtra Board

Board Question Paper: March 2023

Subject: Biology | Max. Marks: 70 | Time: 3 Hrs.

Maharashtra State Board of Secondary and Higher Secondary Education

SECTION - A

Q.1. Multiple Choice Questions

Instructions: Select and write the correct answer along with its alphabet.

i. Histones are rich in _______.
  • (A) Lysine and Arginine
  • (B) Leucine and Methionine
  • (C) Serine and Leucine
  • (D) Phenyl alanine and Lysine
Answer: (A) Lysine and Arginine
ii. How many mitotic divisions take place during the formation of a female gametophyte from a functional megaspore?
  • (A) One
  • (B) Two
  • (C) Three
  • (D) Four
Answer: (C) Three

Explanation: The functional megaspore undergoes 3 successive free nuclear mitotic divisions to form an 8-nucleate embryo sac.

iii. Which of the following is the only gaseous plant growth regulator?
  • (A) ABA
  • (B) Cytokinin
  • (C) Ethylene
  • (D) Gibberellin
Answer: (C) Ethylene
iv. The pH of nutrient medium for plant tissue culture is in the range of _______.
  • (A) 2 to 4.2
  • (B) 5 to 5.8
  • (C) 7 to 7.5
  • (D) 8 to 9.5
Answer: (B) 5 to 5.8
v. Rivet Popper Hypothesis is an analogy to explain the significance of _______.
  • (A) Biodiversity
  • (B) natality
  • (C) sex-ratio
  • (D) age distribution ratio
Answer: (A) Biodiversity
vi. Which of the following group shows ZW-ZZ type of sex determination?
  • (A) Pigeon, Parrot, Sparrow
  • (B) Parrot, Bat, Fowl
  • (C) Bat, Fowl, Crow
  • (D) Sparrow, Fowl, Cat
Answer: (A) Pigeon, Parrot, Sparrow

Explanation: ZW-ZZ type is found in birds.

vii. In Hamburger’s phenomenon, _______.
  • (A) Cl– diffuse into WBCs
  • (B) Cl– diffuse into RBCs
  • (C) Na+ diffuse into RBCs
  • (D) Na+ diffuse into WBCs
Answer: (B) Cl– diffuse into RBCs
viii. Calcium and Phosphate ions are balanced between blood and other tissues by ______.
  • (A) Thymosin and Parathormone
  • (B) Calcitonin and Somatostatin
  • (C) Collip’s hormone and Calcitonin
  • (D) Calcitonin and Thymosin
Answer: (C) Collip’s hormone and Calcitonin

Note: Collip's hormone is another name for Parathormone (PTH).

ix. Identify the INCORRECT statement.
  • (A) In a flaccid cell, T.P. is zero
  • (B) In a turgid cell, DPD is zero
  • (C) In a fully turgid cell, TP = OP
  • (D) Water potential of pure water is negative
Answer: (D) Water potential of pure water is negative

Explanation: The water potential of pure water is zero (at standard temperature and pressure).

x. Which of the following is a hormone releasing contraceptive?
  • (A) Cu-T
  • (B) Cu-7
  • (C) Multiload-375
  • (D) LNG-20
Answer: (D) LNG-20

HSC Biology

Q.2. Answer the following questions (VSA)

i. Which disease is caused by HPV?
Answer: Genital warts (or Cervical cancer).
ii. Which device is used to clean both dust and gases from polluted air?
Answer: Scrubber (Specifically, a wet scrubber can remove water-soluble gases like SO₂ and also particulate matter/dust).
iii. Mention the name of sterile animal produced by intergeneric hybridisation.
Answer: Mule (Cross between male Donkey and female Horse).
iv. Give the name of first transgenic plant.
Answer: Tobacco.
v. A child has low BMR, delayed puberty and mental retardation. Identify the disease.
Answer: Cretinism (Congenital Hypothyroidism).
vi. Identify ‘A’ in the given graph of population growth:
[Graph showing Sigmoid Curve: Lag phase -> 'A' -> Stationary]
Answer: Exponential phase (or Log phase).
vii. Complete the following box with reference to symptoms of mineral deficiency:
Abscission Pre-mature fall of flowers, fruits and leaves
? Appearance of green and non-green patches on leaves
Answer: Mottling (or Mosaic).
viii. Give an example of plant having both kidney and dumb-bell shaped guard cells in stomata.
Answer: This question likely asks for examples of plants for both types.
Kidney shaped: Sunflower (Dicot).
Dumb-bell shaped: Maize (Monocot).
SECTION - B

Attempt any EIGHT of the following questions

Q.3. Define the terms:
a. Gross Primary Productivity
b. Net Primary Productivity
Answer: a. Gross Primary Productivity (GPP): It is the rate of production of organic matter (biomass) during photosynthesis. It represents the total solar energy trapped by the plant.

b. Net Primary Productivity (NPP): It is the amount of biomass or organic matter available for consumption by heterotrophs (herbivores and decomposers). It is calculated as GPP minus respiration losses (R). (NPP = GPP - R).
Q.4. Draw a neat diagram of thyroid gland and label thyroid follicle, follicular cells and blood capillaries.
Answer:
[Diagram of Histology of Thyroid Gland]
Labels required:
1. Thyroid Follicle (The circular structures)
2. Follicular Cells (Cuboidal epithelium lining the follicle)
3. Blood Capillaries (In the connective tissue/stroma between follicles)
(Also: Colloid inside the follicle)
Q.5. i. Give reason – ABA is also known as antitranspirant.
ii. Explain the role of chlorophyllase enzyme in banana.
Answer: i. ABA (Abscisic Acid) is called an antitranspirant because, during water stress or drought conditions, it induces the closure of stomata to reduce the rate of transpiration and prevent water loss.

ii. In bananas, the enzyme chlorophyllase degrades the green pigment chlorophyll. This degradation results in the unmasking of other pigments (like carotenoids/xanthophylls), causing the peel to turn yellow during ripening.
Q.6. Complete the chart showing human proteins produced by rDNA technology to treat human diseases and re-write.
Disorders/diseases Recombinant Proteins
? Erythropoietin
Asthma ?
? Tissue plasminogen activator
Emphysema ?
Answer: 1. Disorder for Erythropoietin: Anemia.
2. Protein for Asthma: DNase (Note: DNase is primarily used for Cystic Fibrosis to treat mucus accumulation, but is often the expected answer in this context for respiratory disorders).
3. Disorder for Tissue plasminogen activator: Heart Attack / Myocardial Infarction.
4. Protein for Emphysema: Alpha-1 antitrypsin.
Q.7. i. Define – Imbibition.
ii. Explain how imbibition helps root hairs in adsorption of water.
Answer: i. Imbibition: It is the adsorption of water by hydrophilic colloids (solid particles) resulting in an increase in volume without forming a solution.

ii. Role in Root Hairs: The cell wall of root hairs is made up of pectic compounds and cellulose, which are hydrophilic colloids. These substances imbibe water from the surrounding soil, facilitating the initial adsorption and movement of water into the root hair cell.
Q.8. Draw a neat diagram of the conducting system of human heart and label AV node, Bundle of His and Purkinje fibres.
Answer:
[Diagram of Human Heart Conducting System]
Labels required:
1. AV Node (Atrio-Ventricular Node) - at the base of right atrium.
2. Bundle of His (AV Bundle) - arising from AV node towards septum.
3. Purkinje Fibres - spreading into the ventricular walls.
Q.9. Distinguish between heterochromatin and euchromatin with reference to staining property and activity.
Answer:
Feature Heterochromatin Euchromatin
Staining Property It stains strongly and appears dark. It stains lightly and appears light.
Genomic Activity It is genetically inactive (transcriptionally inert). It is genetically active (transcriptionally active).
Q.10. Complete the following chart regarding energy flow in an Ecosystem and re-write:
Answer:
Role Example
Primary Consumer Herbivores
Primary Producer Green Plants / Algae
Tertiary Consumer (or Top Carnivore) Man, Lion
Secondary consumer Small Carnivores (e.g., Wolf, Frog)
Q.11. i. What is biofortification?
ii. Mention one example each of fortification with reference to –
a. Amino acid content
b. Vitamin-C content
Answer: i. Biofortification: It is the method of breeding crops with higher levels of vitamins, minerals, or higher protein and healthier fats to improve public health.

ii. Examples:
a. Amino acid content: Maize hybrids (Shakti and Rattan) rich in Lysine and Tryptophan.
b. Vitamin-C content: Bitter gourd, Tomato, Mustard, Bathua (enriched varieties).
Q.12. Differentiate between X-chromosome and Y-chromosome with reference to –
i. length of non-homologous regions
ii. type as per position of centromere.
Answer: i. Length of non-homologous regions: The X-chromosome has a longer (larger) non-homologous region containing more genes, while the Y-chromosome has a shorter (smaller) non-homologous region.

ii. Type as per position of centromere: The X-chromosome is Sub-metacentric, while the Y-chromosome is Acrocentric.
Q.13. Define the terms:
i. Genetic drift
ii. Homologous organs
Answer: i. Genetic drift: It refers to the random change in allele frequency occurring by chance in a small population.

ii. Homologous organs: Organs that have the same structural origin and basic plan but may perform different functions (e.g., forelimbs of human, bat, and whale). They indicate divergent evolution.
Q.14. i. What is ex-situ conservation?
ii. Mention any two places where the ex-situ conservation is undertaken.
Answer: i. Ex-situ conservation: It is the conservation of threatened animals and plants outside their natural habitat in special settings where they can be protected and cared for.

ii. Places: Zoological parks, Botanical gardens, Seed banks, or Cryopreservation centers.
SECTION - C

Attempt any EIGHT of the following questions

Q.15. i. Define – Incomplete dominance.
ii. If a red flowered Mirabilis jalapa plant is crossed with a white flowered plant, what will be the phenotypic ratio in F2 generation? Show it by a chart.
Answer: i. Incomplete dominance: It is a phenomenon where neither of the two alleles of a gene is dominant over the other, resulting in a heterozygous phenotype that is intermediate between the two homozygous phenotypes.

ii. Chart for F2 Generation:
P generation: Red (RR) × White (rr)
F1 generation: All Pink (Rr)
Selfing F1: Pink (Rr) × Pink (Rr)
F2 Ratio:
- 1 Red (RR)
- 2 Pink (Rr)
- 1 White (rr)
Phenotypic Ratio: 1 : 2 : 1 (Red : Pink : White).
Q.16. i. Differentiate between sympathetic and parasympathetic nervous system with reference to the following:
a. Pre and post ganglionic nerve fibres.
b. Effect on heart beat.
ii. Give reason – All spinal nerves are of mixed type.
Answer: i. Differences:
a. Nerve Fibres: In Sympathetic, pre-ganglionic fibres are short and post-ganglionic are long. In Parasympathetic, pre-ganglionic fibres are long and post-ganglionic are short.
b. Heart beat: Sympathetic system increases the heart beat. Parasympathetic system decreases the heart beat.

ii. Reason: All spinal nerves are formed by the union of a dorsal sensory root (carrying sensory impulses) and a ventral motor root (carrying motor impulses). Thus, every spinal nerve contains both sensory and motor fibres, making them mixed nerves.
Q.17. i. Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
ii. How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5' GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA 3'
Answer: i. Diagram:
[Diagram of Replication Fork]
Labels: Leading Strand, Lagging Strand, Okazaki Fragments, RNA Primer, Template Strands.

ii. Amino Acid Count:
The given mRNA sequence is:
5' GCC ACA UGG AGA UGA CGA CAA AAU UUU ACU AGA AAA 3'

Logic: Translation typically starts at the start codon (AUG) and ends at a stop codon. However, in this sequence, the 5th triplet is UGA, which is a Stop codon.
- If we read triplets from the 5' end: GCC, ACA, UGG, AGA, UGA (Stop). This produces 4 amino acids.
- Note: Biologically, translation requires an AUG start codon. If we scan for the first AUG, it appears at the 6th nucleotide index, but board problems of this type often test the recognition of the stop codon in the reading frame provided by the spacing.
Final Answer: 4 amino acids (Translation stops at the UGA stop codon).
Q.18. Describe the steps in breathing.
Answer: Breathing (Ventilation) involves two main steps:
1. Inspiration (Inhalation): An active process where atmospheric air enters the lungs.
  • The diaphragm muscles contract, making the diaphragm flat and pushing it downwards.
  • The external intercostal muscles contract, pulling the ribs and sternum upwards and outwards.
  • This increases the volume of the thoracic cavity, decreasing the intra-pulmonary pressure. Air rushes in from high pressure (atmosphere) to low pressure (lungs).
2. Expiration (Exhalation): A passive process where air leaves the lungs.
  • The diaphragm relaxes and becomes dome-shaped.
  • The external intercostal muscles relax, returning ribs and sternum to their original position.
  • This decreases the thoracic volume, increasing the intra-pulmonary pressure. Air is expelled out.
Q.19. i. What is spermatogenesis?
ii. Draw a neat and labelled diagram of spermatogenesis.
Answer: i. Spermatogenesis: It is the process of formation of haploid male gametes (sperms/spermatozoa) from the diploid germinal epithelium (spermatogonia) of the testis.

ii. Diagram:
[Diagram of Spermatogenesis]
Structure to show:
- Spermatogonia (2n) -> Mitosis
- Primary Spermatocyte (2n) -> Meiosis I
- Secondary Spermatocytes (n)
- Spermatids (n) -> Spermiogenesis
- Spermatozoa (Sperms) (n)
Q.20. i. What is a connecting link?
ii. Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
Answer: i. Connecting link: An organism (living or fossil) that possesses characters of two different groups of organisms, indicating their evolutionary relationship, is called a connecting link.

ii. Fossil Animal: Archaeopteryx.
- Reptilian Character: Presence of teeth in jaws, long tail with vertebrae, or claws on wings.
- Avian (Bird) Character: Presence of feathers covering the body, modification of forelimbs into wings, or presence of a beak.
Q.21. Complete the following chart regarding population interaction and re-write:
Sr. No. Name of interaction Interaction between
1 ? Plasmodium and Man
2 ? Leopard and Lion
3 ? Clown fish and Sea-anemone
Answer: 1. Parasitism
2. Competition
3. Commensalism
Q.22. i. What is composition of bio-gas?
ii. Mention any four benefits of bio-gas.
Answer: i. Composition: Biogas mainly consists of Methane (CH₄) [50-70%], Carbon dioxide (CO₂) [30-40%], and traces of Hydrogen (H₂), Nitrogen (N₂), and Hydrogen Sulphide (H₂S).

ii. Benefits: 1. It provides a cheap and safe fuel for cooking and lighting. 2. It is an eco-friendly and pollution-free energy source. 3. The leftover sludge is a rich fertilizer (manure). 4. It helps in effective waste management and sanitation.
Q.23. i. Give reason – Water acts as thermal buffer.
ii. Draw a neat and proportionate diagram of root hair and label mitochondria, nucleus and vacuole.
Answer: i. Reason: Water has a high specific heat capacity, meaning it requires a large amount of energy to change its temperature. This property allows it to absorb or release heat with minimal temperature change, thus acting as a thermal buffer to maintain constant body temperature in organisms.

ii. Diagram:
[Diagram of Root Hair Cell]
Labels required:
- Nucleus (Peripheral, pushed by vacuole)
- Vacuole (Large central)
- Mitochondria (In the cytoplasm)
Q.24. Explain three main functions of free antibodies produced by B-lymphocytes.
Answer: The three main functions of antibodies are: 1. Agglutination: Antibodies bind to antigens (like bacteria) forming clumps, immobilizing them for easier destruction by phagocytes. 2. Opsonization: Antibodies coat the surface of pathogens (bacteria), making them more appetizing and easier for phagocytes (macrophages) to engulf and destroy. 3. Neutralization: Antibodies bind to toxins or viruses, neutralizing their harmful effects and preventing them from entering host cells.
Q.25. i. Following are the diagrams of entry of pollen tube into ovule. Identify the type A and B.
ii. Give any four points of significance of double fertilization.
[Image A: Pollen tube enters through integuments/funicle side]
[Image B: Pollen tube enters through micropyle at the top]
Answer: i. Identification:
A: Mesogamy (Entry through integuments).
B: Porogamy (Entry through micropyle).

ii. Significance of Double Fertilization: 1. It involves the fusion of one male gamete with the egg to form a diploid Zygote, which develops into an embryo. 2. It involves the fusion of the second male gamete with polar nuclei to form the triploid Primary Endosperm Nucleus (PEN), which develops into nutritive endosperm. 3. It restores the diploid condition of the lifecycle. 4. It ensures that the nutritive tissue (endosperm) is formed only if fertilization is successful, preventing wastage of energy.
Q.26. i. Name the hormone which is responsible for apical dominance.
ii. A farmer wants to remove broad-leaved weeds from the jowar plantation in his field. Suggest any plant hormone to remove such weeds.
iii. Mention any two applications of cytokinin.
Answer: i. Hormone for apical dominance: Auxin (IAA).

ii. Hormone for weed removal: Synthetic Auxins like 2,4-D (2,4-Dichlorophenoxyacetic acid). It acts as a selective herbicide for broad-leaved weeds.

iii. Applications of Cytokinin: 1. Promotion of cell division (Cytokinesis). 2. Delaying senescence (aging) of leaves (Richmond-Lang effect). (Other options: Breaking seed dormancy, inducing shoot formation in tissue culture).
SECTION - D

Attempt any THREE of the following questions

Q.27. i. What is blood pressure?
ii. Give the name of the instrument which is used to measure the blood pressure.
iii. Differentiate between an artery and a vein with reference to lumen and thickness of wall.
Answer: i. Blood Pressure: It is the lateral pressure exerted by the flowing blood on the walls of the blood vessels (mainly arteries).

ii. Instrument: Sphygmomanometer.

iii. Difference between Artery and Vein:
Feature Artery Vein
Thickness of wall Thick, muscular, and elastic wall. Thin and less muscular wall.
Lumen Narrow lumen (cavity). Wide lumen (cavity).
Q.28. i. Describe any three adaptations in anemophilous flowers. Mention any one example.
ii. Describe any three adaptations in hydrophilous flowers. Mention any one example.
Answer: i. Anemophilous (Wind-pollinated) Flowers:
Adaptations: 1. Flowers are small, inconspicuous, colorless, without nectar and fragrance. 2. Pollen grains are light in weight, dry, and produced in large numbers to ensure pollination. 3. Stigma is feathery to trap pollen, and stamens have versatile anthers to release pollen easily.
Example: Maize, Wheat, Grasses.

ii. Hydrophilous (Water-pollinated) Flowers:
Adaptations: 1. Flowers are small, inconspicuous, and without nectar or fragrance. 2. Floral parts and pollen grains are often coated with mucilage to prevent wetting. 3. Pollen grains are long and needle-like (in Hypohydrophily) or float on the surface (in Epihydrophily).
Example: Vallisneria (Epihydrophily) or Zostera (Hypohydrophily).
Q.29. i. What is polymerase chain reaction (PCR)?
ii. Describe three steps involved in mechanism of PCR.
Answer: i. PCR: Polymerase Chain Reaction is an in vitro technique used to amplify (make multiple copies of) a specific segment of DNA in a very short time.

ii. Steps in PCR: 1. Denaturation (90-98°C): The double-stranded DNA is heated to high temperature to break the hydrogen bonds, separating the two strands. 2. Annealing (40-60°C): The temperature is lowered to allow two specific oligonucleotide primers to bind (anneal) to the complementary sequences on the single-stranded DNA templates. 3. Extension / Polymerization (70-75°C): The thermostable enzyme Taq polymerase adds nucleotides to the primers, synthesizing new DNA strands complementary to the templates.
Q.30. i. Give any four significances of fertilization in human.
ii. Mention the names of any two organs each derived from ectoderm and mesoderm.
Answer: i. Significance of Fertilization: 1. It restores the diploid number of chromosomes (2n) in the zygote. 2. It combines characters from both parents, leading to genetic variation. 3. It determines the sex of the offspring (XX or XY). 4. It stimulates the secondary oocyte to complete meiosis II and initiates cleavage (development).

ii. Derivatives: - From Ectoderm: Epidermis of skin, Nervous system (Brain/Spinal cord), Retina of eye, Enamel of teeth. - From Mesoderm: Dermis of skin, Muscles, Bones/Cartilage, Heart/Blood vascular system, Kidneys.
Q.31. i. Give any two functions of cerebellum.
ii. Write the names of any four motor cranial nerves with their appropriate serial number.
iii. Which hormones stimulate liver for glycogenesis and glucogenolysis?
Answer: i. Functions of Cerebellum: 1. Maintains equilibrium, posture, and balance of the body. 2. Coordinates voluntary muscle movements (walking, running) and regulates muscle tone.

ii. Motor Cranial Nerves: - III : Oculomotor - IV : Trochlear - VI : Abducens - XI : Spinal Accessory - XII : Hypoglossal
(Select any four).

iii. Hormones: - For Glycogenesis (Glucose to Glycogen): Insulin. - For Glucogenolysis (Glycogen to Glucose): Glucagon.
Question Paper Page No. 1 Question Paper Page No. 2 Question Paper Page No. 3 Question Paper Page No. 4

HSC OCM Board Question Paper February 2023 Maharashtra Board Marathi Medium

बोर्ड प्रश्नपत्रिका : फेब्रुवारी २०२३

वाणिज्य संघटन व व्यवस्थापन

वेळ: ३ तास एकूण गुण : ८०

सूचना:

  1. सर्व प्रश्न सोडविणे अनिवार्य आहे.
  2. उजव्या बाजूस दिलेले अंक प्रश्नांचे पूर्ण गुण दर्शवितात.
  3. डाव्या बाजूस दिलेले अंक प्रश्नांचे क्रमांक दर्शवितात.
  4. प्रत्येक प्रश्नाच्या उत्तराची सुरुवात नवीन पानावर करावी.
प्र.१. (अ) रिकाम्या जागी योग्य पर्याय निवडून विधाने पुन्हा लिहा. [५] [२०]
(१) संज्ञापन साखळी म्हणजे _______ पदक्रमानुसार उच्च स्तरापासून कनिष्ठ स्तरापर्यंत केलेला संवाद.
(अ) शिस्त (ब) ऐक्य (क) अधिकार
(२) नाशवंत वस्तू _______ गोदामात साठविल्या जातात.
(अ) करदेय (ब) शीतगृह (क) सरकारी
(३) ऑनलाईन व्यवहार करण्यास _______ आवश्यक असते.
(अ) नोंदणी (ब) व्यापार (क) व्यवसाय
(४) जिल्हा ग्राहक आयोगाचे अध्यक्ष _______ असतात.
(अ) जिल्हा न्यायाधीश (ब) उच्च न्यायालयाचे न्यायाधीश (क) सर्वोच्च न्यायालयाचे न्यायाधीश
(५) किरकोळ बाजार हा असा बाजार आहे, की जेथे किरकोळ व्यापारी प्रत्यक्षपणे मालाची विक्री _______ यांना लहान प्रमाणात करतो.
(अ) उत्पादक (ब) घाऊक व्यापारी (क) उपभोक्ता

12th OCM Board Papers (March & July 2025)

(ब) योग्य जोड्या जुळवा. (५)
'अ' गट 'ब' गट
(अ) हेन्री फेयॉल (१) एक प्रक्रिया जी सूचना, मार्गदर्शन, संवाद आणि प्रेरणा देते
(ब) निर्देशन (२) शास्त्रीय व्यवस्थापनाचा सिद्धांत
(क) शासनाप्रती जबाबदारी (३) एक प्रक्रिया ज्यात भरती, निवड, रुजू होणे व मोबदला ठरविला जातो
(ड) डिजिटल रोख (४) नफा मिळविणे
(इ) मक्तेदारी (५) नियम व कायद्यांचा आदर
(६) फक्त सायबर स्पेसमध्येच अस्तित्व
(७) सर्वत्र अस्तित्व
(८) एकच खरेदीदार
(९) आधुनिक व्यवस्थापनाचा सिद्धांत
(१०) एकच विक्रेता

12th OCM Board Papers (March & July 2024)

(क) खालील विधाने 'बरोबर' की 'चूक' ते लिहा. (५)
(१) एफ. डब्ल्यू. टेलर यांनी व्यवस्थापनाची १४ तत्त्वे विकसित केली.
(२) चालू खाते हे नोकरदार व्यक्ती उघडतात.
(३) अनियंत्रित बाजार हा मागणी व पुरवठ्याच्या प्रभावावर चालतो.
(४) ग्राहक बाजारपेठेचा राजा असल्यामुळे त्यास कोणत्याही जबाबदाऱ्या नाहीत.
(५) लोक अदालत लोक न्यायालय म्हणून ओळखले जाते.

12th OCM Board Papers (February & July 2023)

(ड) गटात न बसणारा शब्द ओळखा. (५)
(१) नियोजन, संघटन, कर्मचारी व्यवस्थापन, लेखन
(२) ट्रेकिंग, वन्यजीव अभ्यास, घोडेस्वारी करणे, बैठे खेळ
(३) प्राथमिक पतसंस्था, राज्य सहकारी बँक, जिल्हा सहकारी बँक, विनिमय बँक
(४) B to B, B to C, A to Z, C to C
(५) भाग बाजार, परकीय चलन, सोने-चांदी बाजार, उत्पादित वस्तूंचा बाजार

12th OCM Board Papers (2014 - 2022)

  • OCM - March 2022 English Medium: View
  • OCM - March 2022 Marathi Medium: View | Answer Key
  • OCM - July 2022 English Medium: View | Answer Key
  • OCM - March 2020 English Medium: View
  • OCM - March 2020 Marathi Medium: View | Answer Key
  • OCM - March 2019: View
  • OCM - July 2018: View
  • OCM - March 2018: View
  • OCM - July 2017: View
  • OCM - March 2017: View
  • OCM - July 2016: View
  • OCM - March 2016: View
  • OCM - July 2015: View
  • OCM - March 2015: View
  • OCM - October 2014: View
  • OCM - March 2014: View
प्र.२. खालील संज्ञा / संकल्पना स्पष्ट करा (कोणत्याही चार). [८]
(१) व्यवस्थापन
(२) सामाजिक जबाबदारी
(३) विश्वस्त संकल्पना
(४) जनहित याचिका
(५) बांधणी/परिवेष्टन
(६) उत्पादन
प्र.३. खालील घटना किंवा परिस्थितीचा अभ्यास करून आपले मत लिहा (कोणतेही दोन). [६]
(१) श्री. राम, एक उद्योन्मुख उद्योजक यांनी आपल्या नवीन व्यवसायासाठी जमीन, पैसा, यंत्रसामग्री आणि कामगार वर्ग इत्यादी आवश्यक संसाधनांचा विचार करून आपल्या व्यवसाय संस्थेची रचना तयार केली आहे. त्यांनी श्री. श्याम यांना व्यवस्थापक म्हणून नियुक्त केले. श्री. राम यांनी कर्मचाऱ्यांची भरती, निवड, प्रशिक्षण, विकास आणि वेतन ठरविणे यांसारख्या जबाबदाऱ्या श्री. श्याम यांना दिल्या आहेत. श्री. राम यांनी कर्मचाऱ्यांना दिलेल्या मानकांनुसार कर्मचाऱ्यांनी केलेल्या कामांवर देखरेखीसाठी श्री. शुभम यांचीही नियुक्ती केली आहे. तसेच, गरजेनुसार श्री. शुभम कर्मचाऱ्यांना उपाययोजना सुचवतात. या संदर्भात खालील व्यक्तींकडून व्यवस्थापनाची कोणती कार्ये सादर केली जातात?
(१) श्री. राम
(ब) श्री. श्याम
(क) श्री. शुभम
(२) श्री. अमित हे व्यावसायिक आहेत. त्यांचे पुणे आणि नाशिक येथे कारखाने आहेत. श्री. अमित हे कुटुंबासह पुण्यामध्ये स्थायिक असून त्यांना ५ आणि ८ वर्षे वयाच्या दोन मुली आहेत.
(अ) श्री. अमित हे त्यांच्या पत्नी व दोन मुलींसाठी जीवन विमा घेऊ शकतात का?
(ब) श्री. अमित हे सागरी विमा त्यांच्या कारखान्यासाठी घेऊ शकतात का?
(क) आगीमुळे कारखान्याच्या होणाऱ्या नुकसानीच्या भरपाईसाठी कोणत्या प्रकारचा विमा श्री. अमित घेऊ शकतात?
(३) श्री. अथर्व यांनी धनादेशाद्वारे पैसे दिले आणि त्याचवेळी श्री. समर्थ यांनी (फंड ट्रान्स्फर) निधी वर्ग द्वारे पैसे दिले, तर...
(अ) कोणाचे पैसे जलद पद्धतीने दिले जातात?
(ब) कोणाचे पैसे देण्याची पद्धती ही पारंपरिक मार्गाने केली आहे?
(क) कोणाची पैसे देण्याची पद्धती ही इ-व्यवसायाशी संबंधित आहे?
प्र.४. खालील फरक स्पष्ट करा (कोणतेही तीन). [१२]
(१) चालू खाते आणि मुदत ठेव खाते
(२) संघटन आणि निर्देशन
(३) राज्य आयोग आणि राष्ट्रीय आयोग
(४) इ-वाणिज्य आणि इ-व्यवसाय
प्र.५. खालील प्रश्नांची थोडक्यात उत्तरे लिहा (कोणतेही दोन). [८]
(१) शास्त्रीय व्यवस्थापनाच्या कोणत्याही चार तंत्रांचे वर्णन करा.
(२) ग्राहक संरक्षणाच्या कोणत्याही चार गरजा स्पष्ट करा.
(३) विपणनाची कोणतीही चार कार्ये स्पष्ट करा.
प्र.६. खालील विधाने सकारण स्पष्ट करा (कोणतेही दोन) [८]
(१) नियंत्रण हे व्यवस्थापनाचे अंतिम कार्य आहे.
(२) उद्योजकता हा स्वयंरोजगाराचा सर्वात चांगला स्रोत आहे.
(३) ए. टी. एम. मधून कधीही पैसे काढता येतात.
(४) ग्राहकांस अनेक जबाबदाऱ्या आहेत.
प्र.७. खालील प्रश्न सोडवा (कोणतेही दोन). [१०]
(१) व्यवस्थापन तत्त्वाचे स्वरूप स्पष्ट करा.
(२) पोस्टाने पैसे (निधी) पाठविण्याच्या सेवा व सामान्य सेवा स्पष्ट करा.
(३) ग्राहकांप्रति व्यवसाय संघटनांच्या सामाजिक जबाबदाऱ्या स्पष्ट करा.
प्र.८. खालील प्रश्नांची सविस्तर उत्तरे लिहा (कोणतेही एक). [८]
(१) रस्ते वाहतूक म्हणजे काय? रस्ते वाहतुकीचे फायदे आणि तोटे सांगा.
(२) समाज व ग्राहकांसाठी विपणनाचे असणारे महत्त्व स्पष्ट करा.
Maharashtra Board OCM Paper 2023

HSC Economics Question Paper Solution March 2023 | Maharashtra Board

BOARD QUESTION PAPER : MARCH 2023
ECONOMICS

Time: 3 Hrs. | Max. Marks: 80

Q.1. (A) Complete the following sentences: (5)

i. Micro Economics is also called as _______.
Answer: (b) Price theory
ii. Money market faces shortage of funds due to _______.
Answer: (a) Inadequate savings
iii. Marginal utility of the commodity becomes negative when Total Utility of a commodity is _______.
Answer: (c) falling
iv. Public expenditure of any government shows _______.
Answer: (b) increasing trend
v. The relationship between income and demand for inferior goods is _______.
Answer: (b) inverse

Economics Board Questions with Solution

(B) Find the odd word out: (5)

i. Revenue concepts:
Total Revenue, Average Revenue, Total Cost, Marginal Revenue.
Answer: Total Cost (The others are revenue concepts).
ii. Quantitative Tools of credit control:
Bank rate, Open market operations, Foreign Exchange rate, Variable reserve ratio.
Answer: Foreign Exchange rate (The others are quantitative tools of credit control by RBI).
iii. Scope of Micro Economics:
Theory of product pricing, Theory of factor pricing, Theory of Economic growth and Development, Theory of Economic welfare.
Answer: Theory of Economic growth and Development (This falls under the scope of Macro Economics).
iv. Non-tax revenue:
Fees, Penalty, Wealth tax, Special levy.
Answer: Wealth tax (This is a direct tax, whereas others are sources of non-tax revenue).
v. Types of Simple Index Number:
Laspeyre’s Price Index Number, Price Index Number, Quantity Index Number, Value Index Number.
Answer: Laspeyre’s Price Index Number (This is a method of Weighted Index Number, others are Simple Index Numbers).

(C) Give economic term: (5)

i. The volume of commodities and services turned out during a given period counted without duplication.
Answer: National Income (or National Product)
ii. A desire which is backed by willingness to purchase and ability to pay.
Answer: Demand
iii. Degree of responsiveness of a change of quantity demanded of a good to a change in its price.
Answer: Price Elasticity of Demand
iv. Very realistic competition in nature.
Answer: Monopolistic Competition
v. Swati purchased raincoat for her father in rainy season.
Answer: Time Utility

(D) Assertion and reasoning questions: (5)

i. Assertion (A): In perfect competition, price is determined by the forces of demand and supply.
Reasoning (R): The number of buyers and sellers is so large that one person can not influences prices.
Answer: 3. Both (A) and (R) are True and (R) is the correct explanation of (A).
ii. Assertion (A): A change in quantity demanded of one commodity due to a change in the price of other commodity is cross elasticity.
Reasoning (R): Changes in consumers’ income leads to a change in the quantity demanded.
Answer: 4. Both (A) and (R) are True and (R) is not the correct explanation of (A).
(Note: R defines Income Elasticity, while A defines Cross Elasticity. They are distinct concepts.)
iii. Assertion (A): Production for self-consumption is not accounted for in the national income.
Reasoning (R): The products kept for self consumption do not enter the market.
Answer: 3. Both (A) and (R) are True and (R) is the correct explanation of (A).
iv. Assertion (A): Foreign exchange management and control is undertaken by commercial banks.
Reasoning (R): RBI has to maintain the official rate of exchange of rupee and ensure its stability.
Answer: 2. (A) is false, but (R) is true.
(Note: Forex management is the function of the Central Bank/RBI, not Commercial Banks).
v. Assertion (A): Supply is a relative term.
Reasoning (R): Supply is always expressed in relation to price, time and quantity.
Answer: 3. Both (A) and (R) are True and (R) is the correct explanation of (A).

Q.2. (A) Identify and explain the following concepts (Any THREE):

i. A table seller sold the table for ₹ 2,000 per piece. In this way he sold 15 tables and earned ₹ 30,000.
Concept: Total Revenue.
Explanation: Total revenue refers to the total amount of income received by a firm from selling a given amount of commodity. It is obtained by multiplying the Price per unit by the Quantity sold.
Formula: \(TR = P \times Q\) (i.e., \(2000 \times 15 = 30,000\)).
ii. England imported cotton from India, made readymade garments from it and sold them to Malaysia.
Concept: Entrepot Trade (Re-export trade).
Explanation: It refers to the purchase of goods and services from one country for the purpose of selling them to another country. Here, England is processing Indian cotton to sell to Malaysia.
iii. Ashok paid the tax on his income and property.
Concept: Direct Tax.
Explanation: A direct tax is a tax levied on the income or wealth of a person and is paid directly to the government by the person on whom it is imposed. The burden of this tax cannot be shifted to others.
iv. Raju’s father invests his money in a market for long term funds both equity and debt raised within and outside the country.
Concept: Capital Market.
Explanation: Capital market is a market for long-term funds both equity and debt raised within and outside the country. It deals in financial assets having a maturity period of more than one year.
v. A poor person wants to buy a car.
Concept: Desire.
Explanation: Desire is a mere wish to have a commodity. In this case, the poor person has the willingness to purchase but lacks the ability to pay (purchasing power), so it remains a desire and does not become demand.

(B) Distinguish between (Any THREE): (6)

i. Unitary elastic demand and Relatively elastic demand
Unitary Elastic Demand: When a percentage change in price leads to a proportionate (equal) percentage change in quantity demanded. (Ed = 1). The demand curve is a rectangular hyperbola.

Relatively Elastic Demand: When a percentage change in price leads to a more than proportionate change in quantity demanded. (Ed > 1). The demand curve is flatter.
ii. Output method and Income method of measuring national income
Output Method (Product Method): Measures National Income by estimating the total value of final goods and services produced in the country during a year. It approaches NI from the production side.

Income Method: Measures National Income by summing up the factor incomes (Rent, Wages, Interest, Profit) earned by the owners of factors of production. It approaches NI from the distribution side.
iii. Demand deposit and Time deposit
Demand Deposit: Deposits that are repayable on demand (e.g., Savings A/c, Current A/c). They carry low or no interest rates and allow easy withdrawal via cheques/ATMs.

Time Deposit: Deposits that are repayable after a certain fixed period (e.g., Fixed Deposit, Recurring Deposit). They carry higher interest rates and cannot be withdrawn by cheque before maturity without penalty.
iv. Simple Index number and Weighted index number
Simple Index Number: An index number where equal importance (weight) is assigned to all commodities. It is easier to calculate but less accurate.

Weighted Index Number: An index number where weights are assigned to various commodities according to their relative importance. It is more complex but more accurate and realistic.
v. Stock and Supply
Stock: It is the total quantity of a commodity available for sale with a seller at a particular point in time. It is the source of supply. Stock can exceed supply.

Supply: It is that part of the stock which is offered for sale at a specific price during a specific period. Supply cannot exceed stock.

Q.3. Answer the following (Any THREE):

i. Explain any four points of importance of Micro economics.
1. Price Determination: Explains how prices of different products and factors of production are determined.
2. Free Market Economy: Helps in understanding the working of a free market economy where decisions are made by individuals.
3. Foreign Trade: Helps explain gains from trade, BOP disequilibrium, and exchange rate determination.
4. Model Building: Helps in building simple models to understand complex economic situations using various terminologies and tools.
ii. Explain the Ratio or percentage method of measuring price elasticity of demand.
This method was developed by Prof. Marshall. Price elasticity is measured as the ratio of percentage change in quantity demanded to percentage change in price.
Formula: \( Ed = \frac{\% \Delta Q}{\% \Delta P} \)
Where \( \Delta Q \) is change in quantity and \( \Delta P \) is change in price.
Based on the result, it can be elastic (>1), inelastic (<1), or unitary (=1).
iii. Explain any four features of national income.
1. Macroeconomic Concept: It represents the income of the economy as a whole, not an individual.
2. Value of Final Goods: Only the value of final goods and services is included to avoid double counting.
3. Flow Concept: It is a flow of goods and services produced over a period of time (usually a year).
4. Net Aggregate Value: It includes net aggregate value of goods and services, deducting depreciation.
iv. Explain any four problems faced by the money market in India.
1. Dual Structure: Presence of both organized and unorganized sectors leads to lack of coordination.
2. Lack of Uniformity in Rates: Interest rates vary across different sectors and institutions.
3. Shortage of Funds: Inadequate savings and high demand for cash lead to a shortage of funds.
4. Seasonal Fluctuations: Demand for money fluctuates heavily with the agricultural season (busy/slack seasons).
v. Explain any four exceptions of the law of Diminishing marginal utility.
1. Hobbies: For collectors (stamps, coins), MU increases with every addition.
2. Miser: A miser gets more satisfaction with every additional rupee acquired.
3. Addictions: For a drunkard, the level of intoxication and utility increases with every unit consumed.
4. Power: A person's desire for power increases as they acquire more of it.

Q.4. State with reasons whether you agree or disagree with the following statements (Any THREE):

i. There are no exceptions to the law of supply.
I Disagree.
Reason: There are exceptions like:
  • Supply of Labor: After a certain wage level, the supply curve of labor bends backward (workers prefer leisure over work).
  • Agricultural Goods: Supply depends on weather, not just price.
  • Urgent need for cash: Sellers may sell more even at lower prices.
  • Perishable goods: Cannot be stored, so sold at any price.
ii. Balance of Trade and Balance of Payment are two different concepts.
I Agree.
Reason:
  • Balance of Trade (BOT): Includes only visible trade (import and export of goods). It is a narrow concept.
  • Balance of Payment (BOP): Includes visible trade, invisible trade (services), and capital transfers. It is a broader concept representing the systematic record of all economic transactions.
iii. Index numbers are very significant / important in economics.
I Agree.
Reason:
  • They help in framing suitable economic policies.
  • They are useful to study trends and tendencies in the economy (inflation, production).
  • They help in measuring the purchasing power of money (Real wages).
  • They are used as economic barometers.
iv. There are no theoretical difficulties in the measurement of National Income.
I Disagree.
Reason: There are several theoretical difficulties, such as:
  • Transfer Payments: Pension, unemployment allowance etc., are not income earned for productive services.
  • Illegal Income: Income from gambling, smuggling is not accounted for.
  • Unpaid Services: Services of housewives or self-service are excluded.
  • Income of Foreign Firms: Treatment of profits earned by foreign companies.
v. Macro economics is different from Micro economics.
I Agree.
Reason:
  • Micro Economics: Studies individual units (individual consumer, firm). It uses the Slicing Method and Partial Equilibrium.
  • Macro Economics: Studies the economy as a whole (National Income, Aggregate Demand). It uses the Lumping Method and General Equilibrium.

Q.5. Study the following table, figure, passage and answer the questions given below it (Any TWO):

i. Observe the following table and answer the questions given below it: (4)

Solved Table:

Unit of Commodity Total Utility (TU) units Marginal Utility (MU) units
1 6 6
2 11 5
3 15 4
4 15 0
5 14 –1
1. Complete the above table. (2)
The missing values are filled in the table above:
  • At unit 1, MU = TU = 6.
  • At unit 2, TU = TU(1) + MU(2) = 6 + 5 = 11.
  • At unit 4, since TU is constant (15), MU = 0.
  • At unit 5, TU = TU(4) + MU(5) = 15 + (-1) = 14.
2. a. When total utility is Maximum, the marginal utility is – (1)
Answer: Zero (0)
b. When total utility falls, the marginal utility becomes – (1)
Answer: Negative

ii. In the following diagram AE is the linear demand curve... (4)

1. Demand at point ‘C’ is relatively elastic demand. (1)
False (At the geometric midpoint C, demand is Unitary Elastic, Ed = 1).
2. Demand at point ‘B’ is unitary elastic demand. (1)
False (At point B, which is above the midpoint, demand is Relatively Elastic, Ed > 1).
3. Demand at point ‘D’ is perfectly inelastic demand. (1)
False (At point D, below the midpoint, demand is Relatively Inelastic, Ed < 1. Perfectly inelastic is at point E on the X-axis).
4. Demand at point ‘A’ is perfectly elastic demand. (1)
True (At the Y-intercept, elasticity is infinite).

iii. Read the given passage and answer the questions: (4)

1. Explain the meaning of Index Number. (1)
Answer: Index Number is a statistical technique or tool used to measure changes in a variable or a group of related variables with reference to time, geographical location, and other characteristics.
2. To whom the Index Number is useful? (1)
Answer: Index numbers are useful for economists, farmers, traders, government, educationalists, and trade union leaders.
3. Express your opinion about the given passage. (2)
Answer: The passage highlights the multidisciplinary significance of Index Numbers. It emphasizes that Index Numbers are not just limited to Economics but are essential tools for planning and policy implementation in various fields like Sociology, Psychology, and History. It also outlines the scientific method of construction (using a base year) which ensures accuracy in comparison.

Q.6. Answer the following questions in detail (Any TWO):

i. State and explain the law of demand with exceptions.

Statement: According to Prof. Alfred Marshall, "Other things being equal, higher the price of a commodity, smaller is the quantity demanded and lower the price of a commodity, larger is the quantity demanded."

Explanation: There is an inverse relationship between price and quantity demanded. This can be explained with a demand schedule (table showing price vs quantity) and a downward sloping demand curve.

Exceptions to the Law of Demand:

  • Giffen Goods: Inferior goods where demand falls even when price falls (Giffen Paradox).
  • Prestige Goods: Rich people buy more expensive goods (diamonds, luxury cars) for status (Veblen effect).
  • Speculation: If people expect prices to rise further, they buy more even at high prices.
  • Habitual Goods: Price changes do not affect demand for addictions (tea, tobacco).
  • Ignorance: Consumers may buy more at high prices thinking expensive means better quality.
ii. Explain the meaning of Monopoly with its features.

Meaning: The term Monopoly is derived from Greek words 'Mono' (Single) and 'Poly' (Seller). It refers to a market structure where there is a single seller having complete control over the supply of the product which has no close substitutes.

Features:

  • Single Seller: There is only one seller/producer, but many buyers.
  • No Close Substitutes: Buyers have no choice; cross elasticity of demand is zero.
  • Barriers to Entry: Legal, natural, or technological barriers prevent competitors from entering the market.
  • Price Maker: The monopolist sets the price himself.
  • Price Discrimination: The firm can charge different prices to different consumers for the same product.
iii. Explain various reasons for the growth of public expenditure.

There has been a continuous growth in public expenditure due to:

  • Increase in the Activities of the Government: Shift from 'Police State' to 'Welfare State' involves education, health, and social security spending.
  • Rapid Increase in Population: Requires more spending on infrastructure and basic needs.
  • Growing Urbanization: Spread of urbanization requires expenditure on water, roads, energy, and transport.
  • Defense Expenditure: Unstable international relations force governments to spend heavily on defense.
  • Spread of Democracy: Democratic governments spend on elections and fulfilling public demands.
  • Inflation: Rising prices increase the monetary cost of government projects and services.
HSC Economics Question Paper Solution March 2023 | Maharashtra Board Page No. 1 HSC Economics Question Paper Solution March 2023 | Maharashtra Board Page No. 2 HSC Economics Question Paper Solution March 2023 | Maharashtra Board Page No. 3 HSC Economics Question Paper Solution March 2023 | Maharashtra Board Page No. 4